Report on FAE1-1 and FAE1-2 sequence diversity survey within the BnaDFFS
Graham Teakle, Neale Grant, Charlotte Allender, Guy Barker, David Pink (2007) Warwick HRI, University of Warwick, UK. Publication in preparation.
Background
Erucic acid is a major genetic determinant affecting the adoption and development of the oilseed crop in the UK and worldwide in the past 35 years. Historically, the first low erucic oilseed rape cultivar, called Oro, was developed from a cross between Nugget and the forage cultivar Liho in 1968 (Agriculture Canada, Saskatoon). Subsequently, Tower became the first Canola grade cultivar. Various studies have shown that much of the variation in erucic acid levels can be explained by two genetic loci (Jourdren et al, 1996; Thorman et al, 1996). The products of the fatty acid elongase loci FAE1-1 and FAE1-2 have been shown to affect the level of erucic acid in oilseed rape by controlling the chain elongation from oleic acid to erucic acid (C18 to C22). These genes have therefore been under active selection during oilseed rape breeding and, depending on the end use of the oils, this has either been for high or low levels of this fatty acid. Published studies have addressed the function of these loci and demonstrated that the cloned genes mapped to QTL controlling the erucic acid content (e.g. Fourman et al, 1998).Aims of this study
In order to provide a proof-of-concept demonstration of the utility of the BnaDFFS for examining diversity at functional loci, a sequence diversity analysis of two fatty acid elongase loci (FAE1-1 and FAE1-2) was performed. The sequence polymorphisms were also compared with the erucic acid content of the lines.Materials and methods
FAE1 sequence diversity analysis. GenomiPhi-amplified DNA from 94 founder lines from set 1 of the BnaDFFS was used as a template for the PCR amplification of the two FAE1 loci. Full length cDNA sequences have been determined for FAE1-1 (Genbank accession no. AY888044 = reverse complement) and FAE1-2 (Genbank accession no. AY888037 = reverse complement) from the Chinese low erucic acid cultivar Zhongshuang No. 9. An alignment of the coding regions of these sequences is given in Table 1. We designed primers that discriminated between the two loci.:- FAE1-1 F ACGTGCGATGACTCGTCGT
- FAE1-1 R GTTTGAAATCCGGGACGTAGTAAT
- FAE1-2 F ACGTGCGATGACTCGTCCT
- FAE1-2 R GCTTGAAGTCCGGGACGTAATAAT
Results
A table comparing the sequence variation at each locus relative to the coding regions of the Zhongshuang No. 9 FAE1-1 and FAE1-2 loci is given in Table 1. This table also gives the proportion of erucic acid expressed as percentage molar concentration of the total fatty acid content of the seed.Findings
- FAE1-1 and FAE1-2 sequence diversity established for a >600 bp coding region sequence for 94 lines of subset 1 of the BnaDFFS
- Most of the detected sequence variation was found in FAE1-1 (A genome locus). For FAE1-2 two polymorphisms were found in only the line Chambere Dzagumhana. This may be due to the primers used for this locus amplifying other FAE1 loci in the genome and masking any sequence variation or it may genuinely reflect a lack of variation at this locus in this region of the gene.
- Katavic et al (2002) have previously shown that a Serine residue at amino acid 282 (S282) was necessary for activity of the enzyme in a yeast expression system. A proline at this residue (P282) was inactive. Table 1 shows that the lines in the DFFS could be divided in two depending on whether they possessed of serine or proline residue at this position. In general, the lines containing a P282 residue were modern low erucic acid varieties and most lines with the S282 residue were high erucic acid lines, including most of the Swedes, a high erucic acid rape line and older varieties. However, there are a number of notable exceptions to this; 7 lines with the S282 allele had a low erucic acid phenotype, while 4 lines with P282 had a high erucic acid phenotype. This suggests that activity of the FAE1 loci is not only controlled by variation at this amino acid.
- Liho, which is the original forage line from which the low erucic acid trait has been introgressed into modern varieties, also possesses the S282 allele and possessed a high erucic acid content. However, Oro was found to have a low erucic acid content as expected. This result could mean that the accession of Liho sourced for inclusion in the BnaDFFS differs from the original accession used in the selections for the low erucic acid trait.
- For FAE1-1 allelic differences at four other residues were also detected, three of which also resulted in amino acid changes. Interestingly, all of these changes were in lines which possessed the S282 allele. This can be interpreted to mean that there is less allelic variation at this locus in the more highly selected modern double low cultivars. These mutations did not appear to have an affect on the erucic acid content.
- The measurements of erucic acid in each of the lines generally gave the expected result compared with the description of the line. 40 of the lines were found to have a very low erucic acid content, two had intermediate values of 8% and 14%, while the remainder had between 21 and 47% erucic acid.
